README file from
GithubMeta Quest Sync
Meta Quest Sync connects an Obsidian desktop vault to the Obsidian AR WebXR experience on Meta Quest. From Obsidian, it exports the vault graph, starts the local bridge and HTTPS tunnel, and displays a QR code for pairing.
The WebXR viewer, Rust bridge and cross-platform orchestration live in the Obsidian-Ar project. This repository contains only the Obsidian community plugin and its release artifacts.
Requirements
- Obsidian desktop;
- Git, Node.js 22.13+ and Rust/Cargo;
cloudflaredavailable onPATH;- FFmpeg (
ffmpegandffprobe) for AV1/HEVC video compatibility; - a local clone of NElscost/Obsidian-Ar;
- Meta Quest with an up-to-date WebXR browser and hand tracking.
The recommended direct-graph mode does not require Blender, Obsidian CLI or the 3D Graph New plugin.
The plugin uses the same Node.js bridge launcher on Windows, Linux, and macOS. If a GUI-launched Obsidian cannot find Node.js, set an absolute path in Settings → Meta Quest Sync → Node.js executable. The companion project README lists package commands for each operating system.
Usage
-
Install and enable Meta Quest Sync in Obsidian.
-
Clone the companion project:
git clone https://github.com/NElscost/Obsidian-Ar.git -
Open Settings → Meta Quest Sync and select the absolute path of that clone.
-
Keep the default HTTPS viewer and choose Cloudflare Quick Tunnel for a temporary session.
-
Select Start AR, then open the generated QR code on the Quest.
Species map blocks support cached GBIF occurrence markers, click-safe map panning, regional photos and sounds, and an IUCN 3.1 status scale. In WebXR, regional recordings can also feed the optional Spectral Trail.
The plugin creates the graph snapshot, compiles the Rust bridge when needed, starts the bridge and tunnel, and places the session credentials inside the URL fragment. The token is not persisted by the plugin.
Self-hosting
The default setup uses the hosted WebXR viewer and a local Rust backend exposed through Cloudflare Tunnel. Both endpoints are configurable:
- you can host the WebXR viewer on any HTTPS server and set its address in Settings → Meta Quest Sync → HTTPS viewer;
- you can self-host the backend and point the plugin at your own URL;
- for a persistent backend address, configure a Cloudflare Named Tunnel in the companion project and select it in the plugin settings.
The viewer and backend may use different domains. The backend still requires the session token and only accepts compatible HTTPS origins.
Commands
- Start AR session;
- Show session QR code;
- Refresh graph snapshot;
- Stop AR session.
The settings page follows the Obsidian/system language when Portuguese is detected and uses English for other languages. Select Interface language → English to force English.
Privacy and network access
Meta Quest Sync reads note paths and links through the Obsidian API to generate
the graph. It starts local cargo, bridge and cloudflared processes through
the companion project. The bridge exposes requested note content and media to
the paired Quest through an HTTPS Cloudflare Tunnel.
Anyone holding both the temporary bridge URL and session token can access the allowed endpoints while the session is active. Keep them private and stop the session when finished. The plugin has no telemetry, advertising, payment flow or account system.
See the main project documentation for tunnel configuration, platform notes, WebXR gestures, troubleshooting and the optional glTF pipeline.
Development
npm ci
npm test
npm run build
The GitHub release tag must exactly match manifest.json and include
main.js, manifest.json and styles.css.
License
Biological visualization blocks
Use fenced Markdown blocks in a note.
Species map
taxon: Pitangus sulphuratus
source: gbif
mode: density
center: [-15, -55]
zoom: 2
style: classic.point
Select a map region to see its inferred name, occurrence count, photos and recordings. Dragging pans the desktop map.
IUCN status
status: LC
system: IUCN 3.1
label: Least Concern
status accepts EX, EW, CR, EN, VU, NT or LC.
FASTA
Paste one or more sequences using standard FASTA headers:
>Pitangus_sulphuratus
ATGAACGAAAATCTATACAAAAGCCTAACATTC
>Philohydor_lictor
ATGAACGAAAATCTATACAAAAGCCTAACATTC
The desktop plugin renders a color-coded, scrollable alignment. Use Alignment, UPGMA tree, and Distances to switch between the sequence grid, a lightweight phylogenetic tree inferred with p-distance, and a distance matrix. Tree inference is on demand and bounded to 64 taxa and 5,000 informative sites; this is intended for exploration and does not replace a reproducible MEGA analysis with an explicit substitution model and bootstrap settings. WebXR first creates a compact raster preview; selecting it opens the paged spatial comparison view. Up to 128 sequences and 500,000 input characters are parsed, with desktop display limited to 10,000 residues per sequence to protect responsiveness.